Gbp5 protein foods
WebAug 11, 2024 · Guanylate binding protein 5 (GBP5) is the interferon (IFN)-inducible subfamily of guanosine triphosphatases (GTPases) and is involved in pathogen defense. … WebMar 26, 2024 · Predicted to enable GTP binding activity; GTPase activity; and protein homodimerization activity. Involved in positive regulation of cytokine production and positive regulation of innate immune response. Acts upstream of or within cellular response to interferon-gamma and response to bacterium. Located in cytoplasmic vesicle. …
Gbp5 protein foods
Did you know?
WebMar 29, 2024 · That gene was guanylate binding protein 5 (GBP5), which helps produce the GBP5 protein. "That caught our attention and interest," said senior author Salah-Uddin Ahmed, a professor in the College ... WebJul 29, 2024 · Gbp5 sgRNA1 5’- ATTGTGGGTCTTTATCGCAC AGG-3’, Gbp5 sgRNA2 5’- CTCAAACATTCAATCTACCG CGG-3’ and Gbp5 sgRNA3 5’-CTGCCCGGCTCGAAGCACAG AGG-3’ targeting exons 2, 6, and 10 respectively ...
WebGBP5. GBP5 belongs to the family of guanylate binding proteins (GBP). Cat.#. Cat.#. GBP5 involved in several pathways and played different roles in them. We selected most pathways GBP5 participated on our site, such as Cytokine Signaling in Immune system, Immune System, Interferon Signaling, which may be useful for your reference. Also, other ... WebJun 2, 2024 · NLRP3 inflammasome is implicated in the pathogenesis of inflammatory bowel diseases (IBD). Since guanylate-binding protein 5 (GBP5) induces the NLRP3 inflammasome activity, we aim to investigate the potential role of GBP5 in IBD pathogenesis. The expression of GBP5, NLRP3 inflammasome, and related cytokines …
WebMar 26, 2024 · GBP5 promotes liver injury and inflammation by inducing hepatocyte apoptosis. Osteoclast fusion and bone loss are restricted by interferon inducible … WebSep 20, 2012 · The deduced 586-amino acid protein has a predicted molecular mass of 67 kD and contains a guanylate-binding site composed of 3 motifs. Fellenberg et al. (2004) identified GBP5a and GBP5b splice variants that both encode a full-length protein, as well as a GBP5ta variant that encodes a C-terminally truncated protein of 489 amino acids …
WebApr 3, 2024 · The GBP5 protein levels of aTB patients were significantly higher than those of non-tuberculosis patients (p < 0.001), and the area under the ROC curve of the GBP5 assay for aTB diagnosis was 0.76.
WebGBP5 has direct interactions with proteins and molecules. Those interactions were detected by several methods such as yeast two hybrid, co-IP, pull-down and so on. We selected … great clips chesterfield crossingWebApr 13, 2016 · GBP5 protein, human Human Immunodeficiency Virus Proteins Viral Regulatory and Accessory Proteins vpu protein, Human immunodeficiency virus 1 … great clips chesterlandWebMechanistically, GBP5 induces hepatocyte apoptosis through the activation of both calpain/caspase 12/caspase 3 and TNFα/caspase 8/caspase 3 signaling pathways. Inhibition of either calpain activity or caspase 3 prevents GBP5-induced cell death. Our data demonstrate that GBP5 expression is induced by toxins or the NIK signaling pathway, … great clips chesterfield michiganWebFeb 19, 2024 · We also examined the protein levels of GBP5 in a collection of 12 glioma cell lines. It was found that the expression levels of GBP5a/b were increased in 5 of 12 (41.67%) ... great clips chesterfield moWebGTP-binding, Nucleotide-binding. Gene summary (Entrez)i. Useful information about the gene from Entrez. This gene belongs to the TRAFAC class dynamin-like GTPase … great clips chestertonWebAmazon.com: 5 Pound Protein Powder great clips chesterland ohWebDec 27, 2024 · Gbp5 mRNA and protein levels were measured by qPCR and Western blot (n = 3–6). (H) Primary hepatocytes were treated with TNFα (10 ng/ml), IFNγ (100 ng/ml), and TNFα plus IFNγ for 12 h, respectively. Gbp5 mRNA and protein levels were measured by qPCR and Western blot. *p < .05. **p < .01. Data represent the mean ± SEM great clips chesterfield va